• Overview
• How is Nuclear DNA Organized?
• Why is Autosomal DNA Ideal for Identity and Parentage Testing?
• What is the basis for autosomal STR testing?
• Steps in DNA Sample Processing
• Raw STR Data
• Interpreting STR Results in a Paternity Test
• Y-STR Analysis
• Mitochondrial DNA Analysis

---

Overview

DNA, an acronym for Deoxyribonucleic Acid, is the genetic material that is found in the nucleus of most cells in the human body (nuclear DNA). DNA is also found in the energy-producing mitochondria contained within every cell in the human body (mitochondrial DNA).

Other important facts about DNA include:

• The same copy of DNA is present in all cells
  
• There are estimated to be 10-100 trillion cells in the human body
  
• Most common DNA identity test uses nuclear DNA from cheek cells
  
• Bone, hair, blood are examples of other sample types

---

How is Nuclear DNA Organized?

Chromosomes - DNA is contained in molecules known as chromosomes. Each individual has 46 total chromosomes or 23 pairs - one of each pair comes from each parent. 22 pairs of chromosomes contain what is called autosomal DNA and the 23rd pair contains DNA that determines the gender of the child. A male is XY and a female is XX. A routine parentage test examines non-coding regions of the autosomal DNA but also examines a section of the 23rd pair of chromosomes to determine if the tested individual is male or female. Our Y-STR test examines the DNA that is present on the Y-chromosome, which is present only in males.

Double Helix – On a more microscopic level, the chromosomes are actually made up of DNA that is present as a double-stranded molecule called a double helix.

Nucleotides - The DNA double helix is a long chain of molecules. Each molecule is formed from the nucleotides (bases) that are like letters of the alphabet. However while the English alphabet has 26 letters, the DNA alphabet has only four letters called nucleotides or bases:

• Adenine (A)
  
• Thymine (T)
  
• Cytosine (C)
  
• Guanine (G)

The bases of the DNA pair with each other to form the double helix. Each DNA double helix has about 3 billion base pairs. When stretched out, it would be equivalent to 6 feet.

Back to top

---

Why is Autosomal DNA Ideal for Identity and Parentage Testing?

Autosomal DNA is the DNA present on 22 of the 23 pairs of chromosomes of an individual. Each individual inherits half of their DNA from their mother and half from their father. Therefore by examining the DNA of a child and his alleged parents, it is possible to confirm if those individuals are his parents.

However while each child of the same parents will inherit 50% of their DNA from each parent, each child will not inherit exactly the same DNA as their sibling. Therefore, two full siblings are only expected to share approximately 50% of their DNA. It is possible to examine their DNA to determine if they are or are not likely to be related. This is called a kinship test.

Back to top

---

What is the basis for autosomal STR testing?

While 99.9% of all DNA in humans is the same from one person to the next, there is approximately 0.1% that is different. It is a portion of this 0.1% of DNA that is examined in routine autosomal STR testing. Due to the fact that this 0.1% of DNA does not have a known function in the human body, it is highly variable from person to person.

The areas which are examined are called STR’s which are Short Tandem Repeats. These STR’s are short sequences of DNA that are repeated a number of times (6-40 times) in a particular location on the DNA. For example, an STR might look like this:

ACGTACGTACGTACGTACGTACGTACGTACGT

These repeats of core DNA sequences (2-7 bases in length) can be thought of as boxcars on a train. Different individuals can have a different number of repeats at the same location. Many STR’s occur on each chromosome; only a subset has been developed for identity testing purposes.

Back to top

---

Steps in DNA Sample Processing

The process of DNA testing is a combination of chemical and biological procedures. The end result is a DNA profile from at least 10 different STR locations (loci) on the DNA molecule. The steps are as follows:

1. Sample Obtained from individual (e.g. mother, child and alleged father in a paternity case)
2. DNA extracted from nucleus of cells
   
3. DNA is amplified at certain STR regions of interest (amplification = copying)
   
4. The individual STR alleles are separated by size
   
5. The individual genotypes are determined
   
6. The genotypes from one individual are compared to another individual (e.g. in a paternity case, the DNA profiles from the child are compared first to the mother and then to the alleged father)
   
7. If a match occurs, the DNA profile is compared to a population database to determine how common the matching allele is found in the general population
   
8. A written report is generated and will include a probability of relatedness

Back to top

---

Raw STR Data

The picture below represents actual results from an STR (Short Tandem Repeat) test. The profile at each STR region (e.g. D3S1358, THO1, etc.) appears as one or two peaks. The size of each peak represents the number of times that the STR is repeated in that person. For example, at the D3S1358 locus, the STR is repeated 14 times on chromosome 3, at that site, and it is repeated 17 times on the other chromosome 3 (chromosomes in humans occur in pairs). The STR profile for this individual at the D3S1358 site would be listed as 14, 17. A similar STR profile is generated for each person involved in the DNA identity test.

Back to top

---

Interpreting STR Results in a Paternity Test

Raw STR data can also be visualized in a linear fashion, similar to a "boxcar" of a train. Each "boxcar" in the diagram below represents a copy of the STR of interest.

By comparing the STR profile of the child, first to the mother, it is possible to determine which of the child’s alleles came from the mother.

In the "Inclusion" example below, the child and mother both have the STR allele that is repeated 5 times. That means that the child’s STR allele that is repeated 3 times, comes from the child’s biological father. One then determines if the alleged father has the STR that is repeated 3 times.

In the "Exclusion" example below, the child’s maternal allele has already been determined to be the "5" and the child’s paternal allele is the "3". One then examines the alleged father’s DNA profile and since it does not contain a "3", this is considered an exclusion.

Each STR region is examined in the manner described above. If, at the end of the test, the laboratory has observed only inclusions between the child and alleged father, a Paternity Index (PI) is calculated for each STR system. This PI is a comparison of obtaining these results if the alleged father is the true father to obtaining these results from a man who is not the father. The calculation of this PI is dependent on the race or ethnicity of the alleged father as it is performed using gene frequencies obtained from population data. Since all the STR systems are inherited independently of one another the PI for each system can be multiplied by the PI’s for all STR systems tested to obtain a Combined Paternity Index (CPI). This CPI can then be converted into a probability of paternity. For example, if the CPI equals 644,144, the probability of paternity is 99.99%.

If, at the end of the test, the DNA of the child and alleged father show exclusions at 3 or more loci, then the alleged father is considered to be excluded as the biological father of the child. In this case, the probability of paternity would be 0.00%. Exclusions at 1 or 2 loci are not considered enough to conclude that the alleged father is not the biological father because there are certain instances when mutations take place during the formation of gametes (in this case sperm) so that the child’s DNA appears not to match that of his/her biological father or mother at a particular loci.

Back to top

---

Y-STR Analysis

DNA that is present on the Y chromosome of males is also found in the nucleus of the cell. This Y-DNA is inherited only by males from their fathers. The diagram below shows the inheritance pattern of the Y-DNA in males. Those represented by a circle are female and those represented by a square are male. All males with the same interior color share the same Y-DNA.

All males who share the same paternal lineage are expected to have the same Y-STR profile, going back many generations. This can be very useful to determine if two living males have a father or fore-father in common, even if the father or fore-father is deceased.

The laboratory procedure for Y-STR analysis is very similar to that used in routine STR analysis. The only difference is that the various STR regions of the Y-chromosome are inherited from father to son as an entire unit called a haplotype.

There is some variation in the Y-STR haplotypes in the male population because there are rare instances of mutations at individual loci. This creates a potentially brand new haplotype that will be passed along to the male children of the son and further down that paternal line.

In a Y-STR test, if the Y-STR profiles between two individuals match, the matching haplotype is compared to a population database to determine the frequency of that haplotype in the male population of the race of the tested individuals. The final results are presented as the probability of shared paternal lineage.

If the Y-STR profiles between two individuals do not match, the two males are said to be excluded as having the same paternal lineage.

Back to top

---

Mitochondrial DNA Analysis

Mitochondrial DNA is present in the mitochondria of every cell and even in those cells which do not have a nucleus. Mitochondrial DNA is inherited maternally but it is passed on to both daughters and sons. Therefore every child (male or female) of a particular woman has an exact copy of his or her mother’s mitochondrial DNA. The diagram below demonstrates the inheritance pattern of mitochondrial DNA. Those represented by a circle are female and those represented by a square are male. Those with the same color interior share the same mitochondrial DNA.

Since mitochondrial DNA mutations occur only once every 50 generations, a maternal line can be traced back many generations using mitochondrial DNA analysis. This technology can be very useful in immigration, genealogy cases or tribal enrollment cases when two or more individuals are trying to prove they are from the same maternal lineage.

Back to top