DNA Testing Resources
Overview
Non-standard samples
Chain of Custody
Results Interpretation
DNA 101
Overview
How is Nuclear DNA Organized?
Why is Autosomal DNA Ideal for Identity and Parentage Testing?
What is the basis for autosomal STR testing?
Steps in DNA Sample Processing
Raw STR Data
Interpreting STR Results in a Paternity Test
Y-STR Analysis
Mitochondrial DNA Analysis
DNA Glossary
Give us a Call1-800-DNA-TEST
Find a Collection Center
Orchid utilizes a network of over 5000 collection sites worldwide.
Orchid utilizes a network of over 5000 collection sites worldwide.
Accreditations
Orchid Cellmark holds multiple accreditations from various organizations and adheres to the standards of each accrediting organization. Compliance by our laboratories to these accreditation requirements provides assurance to our clients that test results provided by Orchid Cellmark are of the highest quality. Clink on the links above to learn more about our accreditations.
Orchid Cellmark holds multiple accreditations from various organizations and adheres to the standards of each accrediting organization. Compliance by our laboratories to these accreditation requirements provides assurance to our clients that test results provided by Orchid Cellmark are of the highest quality. Clink on the links above to learn more about our accreditations.
DNA Testing Resources
DNA 101
What is the basis for autosomal STR testing?
While 99.9% of all DNA in humans is the same from one person to the next, there is approximately 0.1% that is different. It is a portion of this 0.1% of DNA that is examined in routine autosomal STR testing. Due to the fact that this 0.1% of DNA does not have a known function in the human body, it is highly variable from person to person.
The areas which are examined are called STR’s which are Short Tandem Repeats. These STR’s are short sequences of DNA that are repeated a number of times (6-40 times) in a particular location on the DNA. For example, an STR might look like this:
ACGTACGTACGTACGTACGTACGTACGTACGT
These repeats of core DNA sequences (2-7 bases in length) can be thought of as boxcars on a train. Different individuals can have a different number of repeats at the same location. Many STR’s occur on each chromosome; only a subset has been developed for identity testing purposes.